Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0842
Clone ID AY0842
Vector pGT0lxr
Project sanger

Sequence tag AY0842
Sequence
GGCCTTGGAGCGACAGCGACGCAAGATGGCAGCCACCACAGGCTCGG
Sequence Type mRNA
Unitrap ID UNI2026 UNI2027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60680922..60680968 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027694 (AC122503.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167457440..167457486 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078923 (Ube2v1) NM_023230 ubiquitin-conjugating enzyme E2 variant 1 Gene [Source:MGI (curated);Acc:Ube2v1-003]

 
Come back to gene ENSMUSG00000078923


For any suggestions or comments, please send an email to unitrap@crg.es