Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10058G5
Clone ID IST10058G5
Vector VICTR75
Project tigm

Sequence tag IST10058G5BBR1
Sequence
ATGGTGACTCCCTACCATAAAATTAGTTTTGTTGCTACTTCGTAACTGTAATTTTGCTGTTATGAATCTTAATGTAAACA
TCTGATATACAGGATATCTGATATGGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI18298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88753322..88753432 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068921 (Dap3) NM_022994 death associated protein 3 Gene [Source:MGI (curated);Acc:Dap3-001]

 
Come back to gene ENSMUSG00000068921


For any suggestions or comments, please send an email to unitrap@crg.es