Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14595G12
Clone ID IST14595G12
Vector VICTR74
Project tigm

Sequence tag IST14595G12HMR1
Sequence
TTACACACACANGNNANAAAAACAACAACTTAAAACAAAGCTGCCTGTCAAGCCTTATATGGACAGTAAGCTCANANATA
AAATAACATTTTATTTATTTAGAAATTGTGTGAATCAGCTCACATTGGAAAAGGACAGGAGTTTTGGTGTCTTCCCCACC
TTTCAC
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109972118..109972283 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]


Sequence tag IST14595G12BBF1
Sequence
TAAGCACACGCACTTATGTGCATTGGAGGCCAGAAAGGGACGCTGCACTGTCATCCTCTATCACTCTCCTTACTCCCGTG
AGGCAAGGTCTCTTCTTGAAGCTGGGACTCAAGTTTCATTGGCTAAACTGGAAGGTAGCANCTCCCAGTAATGCTCCTGT
CTCAGTGCTGTTCCCATTGCAAGGGAAGCTATGTGAACTGTAAAACCCTCCTATGTGCACATAAAGAAAATGATTGTGAT
TCAGAAACACAGGCTGGGGTCCAAGCATGCCAGGAACAGCAGCTGTTANCCAGGTGCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109971818..109972120 299
NO GENE  

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es