Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10841C1
Clone ID IST10841C1
Vector VICTR76
Project tigm

Sequence tag IST10841C1HMF1
Sequence
CACACAAGGCTGCGGGGGCTTGCTTCANGGGATCCGATA

Sequence Type genomic DNA
Unitrap ID UNI15335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443057..56443094 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]


Sequence tag IST10841C1BBF1
Sequence
CACACAAGGCTGCGGGGGCTTGCTTCAGGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI15335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443057..56443090 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es