Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_329H4-3
Clone ID CMHD-GT_329H4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_329H4-3
Sequence
TTGGTAACATATCTAACTGTTTCCTGATTATAAGAGAGGGAATTGAGCTGAAAACAGCTTCTGAAACCGTTCTCATACCA
AGTTCATCCTGCACGGTACACGCTGGAGAAATGGGCACCTGCTTGTGCTTCAGGGCTAGGGCCACACATCTTCTCTGGAC
ATTAATCTTCTCCTTGTCCTCCTGGTTGGTGCTTTTCTGCCTTGGAACTGTACAGGGAATAGCCACAAGCACAGCTATGC
ATGCCCTTCTGTGTGACAGCTTTCCCACCTGGTGTCACACATGTATTGATCTTTCAAAATGACATTTTGGATTTGAAGTG
ACTGTGATTGATTTTTGTTGTTGTTGTTTGTTTGTTTCAATAAAATGTGTTCCAAGTTG
Sequence Type mRNA
Unitrap ID UNI13348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121422041..121422526 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es