Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_329D5-3
Clone ID CMHD-GT_329D5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_329D5-3
Sequence
AGGCAGTCTAAGGCAAAGCCCTTTAAAAGGTTTGCAGAAAGCACCTACCCCAACACAGTCAGTGGCAAACCACCTGGAAA
AAGAACTAGATATGTTGCTGCATTTAGATGCACCTGTGCAAGAGGAAGGCAATATCTCTCCAGACCAGACATCTCGGGAC
CAGGAACCAGAAAAAGATGGGCAGGTAGCCCAGGAGGAAACAGGTCCTGAAAAACCTTCTGTGACCAGAGAGAAGAATGT
GGAACCTGAGCAGCCAAGCACATCGAAAAATGTCACCGAGGAAGAGCTGGAGGACTGGCTGGACAGCATGATTTCCTGAA
GCGGGGTCAAGGGGGAAGAGTGCCTGAAGCAAATGCTGGTTGCCTTCTGTGTAATGAGCCCGTCTTGTGAGGACGGGCTC
GTTTACCAGCTACCCCATGCTAACACGTCCTGTTATGCTTACAGCAGCCAACACCTACCTCTGTGTTTGATGGCATCTGA
ATATATGTATGAGGCTTGTTTGAGGCTTCATT
Sequence Type mRNA
Unitrap ID UNI13349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112470031..112471244 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es