Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14047E4
Clone ID IST14047E4
Vector VICTR74
Project tigm

Sequence tag IST14047E4HMR1
Sequence
GTAGGGGGGAGGTTGCCAAATACTTCATGTGGAAATTACACAGGTATTCCAAAGGAAGGATGGTTTCTCTTTACCGAATA
AGGGCAAATTTTGTAAATTCCTTGCTTCTGAAGATGAGCACATTTTAAAGAAATGGTTATAACTGGGTGTGGTGATACAC
ACCTGTTATTCCAATCTCTTANAAGGCTGAGGCAGGAGAGTAGTTAGTTTGTGGTCTGCCTGAGTCAAGTTCAAGGCAAG
TTTGAGACAGTAAGACCCTGTCTTGCCACCACCAACAACAATAACAAAAAAAGAAAAAGAAAAGAAAAGAAAAGAAGAGA
AAGAAAGAAAGAGAAAAAGAAAAAGAAAGAAGGCAAGGTTCATTGTTTTTCCATCCTGAGACAGGGTTTCTCTGTGTAGC
CCTGGTGGATCTGGAACTCAAGTTGTGGATCAGGCTGGCCTCAGGCTGGCCTCGAACTCNCAGAGATCCACTTGGTGGTG
GAAGGCATAGGTCATATACCTAGGCNANGAACTGNAAGCTCACAGCATCGTGATGGAACTCTCNNTCTCCTCTCTCAAGG
ANTTGTGANAGNCGTGGGGAGCGANCGACACAN
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87334856..87335446 568
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]


Sequence tag IST14047E4BBF1
Sequence
TTGTAAAGAGAAACCATCCTTCCTTTGGAATACCTGTGTAATTTCCACATGAAGTATTTGGCAACCTCCCCCCTACCTAA
ATCAAACCTGACAGTCATTCAGGTAATATTTCCCTCAGTACTGACTCTAAGTGAGGCATTACGCTGATCTTTTCACACTT
AATAATTTTTAACCCTCACAGCANAGGGAAATCCCACTACACAGATAACAAGCTGTACAGAGAAGTTCAGGGGCTTCCTA
AGGCCACATGTATTGGAGGTGAAGACTTGGGGCCNAGGGATCTGTTGGCTCGTAAGTCACGTGATCACTACACCAGGAAA
CAGAATTTCAGCNNGGTGTTGTCTCAACGTGCAAACTGGCTCCACTTTTGATGATATAAGTANCTGTCTTTCTTTTCTCC
CNCCTTCCCCTCCCTCCTTCCATTCNGCTNANACTANTTCTTGNTNNCNTGCTGCCTTTTAANCATNANNNANANTGNNN
GN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87334466..87334929 434
 
EST/CDNA Est Name
  BF721487.1 - EH109901.1

 
Come back to gene BF721487.1 - EH109901.1


For any suggestions or comments, please send an email to unitrap@crg.es