Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14289A2
Clone ID IST14289A2
Vector VICTR74
Project tigm

Sequence tag IST14289A2BBF1
Sequence
TTGTGACTGTGGCGGGAGTGGCTGGTAATTCCTCCTTACTCACCCTGCACTATGAAGAGGATACAGAGAAAGCTTCTTAT
ACTCCTGATACATTTCAAAGTTTAACAATAACTTAATAAATGACCTGAAATATAGAAAGACATGAACTGTAACTGAAGCT
TCCACTAAAATACATGCTGTTCTTTCTATTAAGTACCCACCGTCCTTGCCTCTAGGACACGAGCAACTCCAGTGCTCCAT
GACAGATTACCAAACACTGCTTACAAGCTCACAGAAGCAATGAACCAAGCCCAGANAAAGGACTTAAAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855139..97855451 311
 
EST/CDNA Est Name
  CX733968.1


Sequence tag IST14289A2HMR1
Sequence
ACATAATGCTTGCGTTCTGACTGTACGACATCTTATATTTNAGCNNTGAGTCGGGTTTGCTTCCCCCAGGACCCCCGAGT
TCCTTCCTCTCTGCCTTCTTTAGAGGTAGGATGGAGGCTGCCTGTTACCCATGCTTTGAAGAGAGGCTGAGCTACAGAGT
GAATAAGCGCGTGGAGGAGGGAGTCTCTGAGTGCAGTTTGTGCTCTTCCCCAGGGTCCTTCTTCATCAGGACTCANTATT
GTTC
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855449..97855691 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es