Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_329G5-3
Clone ID CMHD-GT_329G5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_329G5-3
Sequence
GAGGAAGAGGCTGAATCAGCTGGTGGACAGTCTGCACCAGCTCCGTCTCTATAACCACACGGCCCCGTGGAGCCTGCCCT
CAGCGCTCTCAACTCAAAGCAACAGTCACAGTTTTGACAGTGACCTTGAATGCCTGCTAAAAACTACCATTGAATCTCAC
ACCAAGCCTTCTCCCAAAGTGCCAGGTAAATTGTCCCCGGAAAAACAGGCCCAACTGAGGAACTTCTTGGCC
Sequence Type mRNA
Unitrap ID UNI3595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31865775..31866618 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es