Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_316B4-3
Clone ID CMHD-GT_316B4-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_316B4-3
Sequence
GACTAGAAAGATCTAAAGGGCTGGCTGCCCCTTTCAATAAAGGCGTTCAAGTAATGGCTGGGACTTGGAATGAGGGTGGA
ATAGGGTCTGGCTAGCGTAACCCAGCTCCCGGGCCCTTCAAGAGAAGGCAGCTACATTCAGAAGAGGAGGTATCCCCCCC
CCCCCCCCCAAATGACACCTTAAAGCCATCCTCATAGAACCTACGGATTATTCTTAAAAAAAAATAGAAATCCAGATGTT
CCTATTCCCCTGCCCCTGGCACATGCCTGTATCCCACCCTAAATGTTGGAGGTCGTCAGGGTCTGGCCTGAGGCCCTGAG
GCCAGTGAGTTGGGAAGAGGCTGCACCCTGGTGGCCATGACTGTGCCTGGGCCTGCCTGCCTCTGTGTATTTCAATAAAT
AACTGTTCC
Sequence Type mRNA
Unitrap ID UNI13367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28315951..28316191 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040424 (Hipk4) NM_001033315 homeodomain interacting protein kinase 4 Gene [Source:MGI (curated);Acc:Hipk4-001]

 
Come back to gene ENSMUSG00000040424


For any suggestions or comments, please send an email to unitrap@crg.es