Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14023E12
Clone ID IST14023E12
Vector VICTR74
Project tigm

Sequence tag IST14023E12BBF1
Sequence
NNANGTGCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI23433 UNI33596 UNI33597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77844..77885 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47061425..47061466 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15676362..15676403 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30117963..30118004 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21321542..21321583 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97877117..97877158 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020882 (Cacnb1) NM_145121 calcium channel, voltage-dependent, beta 1 subunit Gene [Source:MGI (curated);Acc:Cacnb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75673205..75673246 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 78113030..78113071 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60613155..60613196 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35009760..35009801 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038784 (Cnot4) NM_016877 CCR4-NOT transcription complex, subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859026]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 120400211..120400252 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9139443..9139484 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 68955248..68955289 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59591800..59591841 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74463186..74463227 42
NO GENE  


Sequence tag IST14023E12HMF1
Sequence
CAATGTGCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47061425..47061466 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77844..77885 42
NO GENE  

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es