Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14649B7
Clone ID IST14649B7
Vector VICTR74
Project tigm

Sequence tag IST14649B7HMR1
Sequence
TANNAACAACTGAAAGGTTTCCAGTGAGAGAATGAAATGTGATCTGATTTGTATTCTTTTAAGAATGAAATGAGAAGAGT
TCATTCAAGTGTATAGAAAGGGACTGTTAGAAACAGAAAATAGGCCTCTGTGGCAGGACTCCTCAGCTAGGATGACAGAA
GGCGCTACATGTCTAAAGCTCAGCAGANCTGTGGTGATTCTGGATTTGGTTTTTGGTTCATTTCTTTTNCATATTTTGGT
TTTTCGAGATGATTGCATTCTGGCTGTTCTGGANNNCNCGTTGTNGACNAANCTGGCTTTGAATTN
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70326189..70326489 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14649B7BBF1
Sequence
CTAAATGTTCCAAAATAAAATCTAAACTCTTAAGCGACTCTTCTGACCCTTTGTGAACTCATATTCCATCCCCAGCTCCT
ACTAGTTCCCCTCTCAGTCACCATCTCAACCAAACTGTCCTTCTTTCTTTCTTGAATTTGCTATTTGGCTCTCTATGCCT
ACAATGCTTTCCCCAAAGACTTTTCTATCTTTGGAGATTTTTTTCTGAGTGTTCTATGGCAGCAAGAAGTATATGCTCCC
AACCAAGGAAATCAGCTGTAATTCTAGACAGACAGTGATGGTGCACATCTTTAATCCCAGCACTCAGGANGCAGAAGGAG
GCAGGTCTCTGATTTCAAGGCTAGCCTGGTCTGCANATAGAGTTCCAAGANAGCCNAGGCTACAAAAAANATGGATGTCT
AACTATGCTGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70326491..70326901 401
 
EST/CDNA Est Name
  CJ076210.1 - BY217457.1 - CJ178484.1 - CJ165611.1 - CJ171247.1 - CA883725.1 - CJ161536.1 - BY213411.1 - CJ162775.1

 
Come back to gene CJ076210.1 - BY217457.1 - CJ178484.1 - CJ165611.1 - CJ171247.1 - CA883725.1 - CJ161536.1 - BY213411.1 - CJ162775.1


For any suggestions or comments, please send an email to unitrap@crg.es