Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14356D2
Clone ID IST14356D2
Vector VICTR74
Project tigm

Sequence tag IST14356D2HMR1
Sequence
AGTGGTCTTGGCTGACACACCCCTTCCCCTGCCCTAAACCTCTCGTCTCCAGCTCCCGAGATTCN
Sequence Type genomic DNA
Unitrap ID UNI22412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8913901..8913964 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]


Sequence tag IST14356D2BBF1
Sequence
CACTCTAACAGGAACTTGTGAGTATGGGCTGAGAGAACCTAGAGGCTAGCATAGACTTCGATATACTAATAGGTAACCAT
CCAGGTTAATGGAGAAGCAATACGGCTTTTGCCAGAAATAAGACTCCTTTTAGGAAGTAGGAACCACCTTCTTAAATCCC
TGAAGGAATCCCGACCTTTGTCTAAATGCCGGATTTTTAAGGAAAGGATTAATTAATTTGTTTGTTTGTTTAGCGTTTAT
TCCTCTGTGTAACGGANTCCTGAAACTCACAGATCACCTGCCACTGCCTCCTANGCGCTGGAATTAAAGGCGTGTTGAAA
CAATTTCTTAANACCTANCACTCTGGGCTTCCTCCTCCTCTTGGCCTCGGCATCGCCTCTGNGTANCCACGTGTCTCACA
CTCTCCNNCCTNTNTGATCTTACTNNATGTGTCCCANTGCCNATCCTATCTATTANNGTNCCNTACCNTNNNTGCNTANT
TCTTGCNNNTTNNNCCCTTCNGCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023156


For any suggestions or comments, please send an email to unitrap@crg.es