Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12510G3
Clone ID IST12510G3
Vector VICTR76
Project tigm

Sequence tag IST12510G3HMF1
Sequence
GATGCACCTACCTCTCCTCTGCCCCCTAAGTGCTGGAATTAAAGGTGTGCACTACCACCACCCGCTTCCTTTGTTACTTT
TTAGGAACAGAAGATTCCCN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60655349..60655447 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]


Sequence tag IST12510G3BBF1
Sequence
GATGCACCTACCTCTCCTCTGCCCCCTAAGTGCTGGAATTAAAGGTGTGCACTACCACCACCCGCTTCCTTTGTTACTTT
TTAGGAACAGAAGATTCCCCAGGCCTCTTCTTTTCACCAGATGGAATTTGAGGTGGGTGGGGTCTTGGTCTGAGGACCGC
CCTCCCTTTCCCTAGAGCTGGCTTCCTGGATTTCCTCGCACCTCGTGGCTCCTACGCTCCATTTGCTGGCGCTCTTTCTG
TTCACACTGCACACTTTATATTTGCCGCGCTTGCTCTGCTTTGTTGTAAACTTGCATAAGGGTGGTACTAAGAACCACAG
GACAAGACAAGATTGCCTGTAGATTTTCTCCACTAATTTTTAATTTAGCCTTAGGGGCAAATTCTCATTCATTCATTCTC
CCTTTCTCTCTCCCTCTCTCCCCCANCCCCCCTCTTTCTGCTTTTGGTGTTTTGGTTTCNAGACAGGGTTTCTCTGTGCA
GCTCTGGTTGTCCTGNNNCTCNNCTNCCTTANNTAAATTCTNNANGCNGAAAGCAGCCNGNTTAN
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60655349..60655892 512
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es