Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10144B7
Clone ID IST10144B7
Vector VICTR76
Project tigm

Sequence tag IST10144B7HMF1
Sequence
TTGCCCAGTTTTTATTAGGGAGTATCAAAGCTAAAGATATTTCCAAAATTCCTGGNNAGTAAGAAGTAGAAGTAAAAAAA
GTTGAGTGCTCCAGCTGTCCTATTACTCAGGTTTCTGACCATGAACCTAGCTTTCTCAGAATCCCACCTTTTTCATTTAA
C
Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86595377..86595536 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]


Sequence tag IST10144B7BBF1
Sequence
TTGCCCAGTTTTTATTANGGAGTATCAAAGCTAAAGATATTTCCAAAATTCCTGGNNAGTAAGAAGTAGAAGTAAAAAAA
GTTGAGTGCTCCAGCTGTCCTATTACTCAGGTTTCTGACCATGAACCTAGCTTTCTCAGAATCCCACCTTTTTCATTTAA
AAAACAAGAAAGCCATGTGTAGTGGCGCATGCCTGCAATCCCAGTATTTTAGAAGTTAACACCTGAGGAACTCAAGANAG
TTTGAGGCCATCTTGGGTTATATAGTAACTGTATGACCAGCTGTGTGTATATGTGTGTGTGTGTGTGTGTGTGTGNGTGT
N
Sequence Type genomic DNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86595217..86595536 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es