Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_309E09-3
Clone ID CMHD-GT_309E09-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_309E09-3
Sequence
ACAGCAATGACAGTGAACTGGAGTTATCCACGGTGCGCCATCAGCCAGAGGGCTTGGACCAGCTACAAGCTCAGACCAAG
TTCACCAAGAAGGAGCTGCAGTCCCTTTACCGAGGCTTCAAGAATGAGTGTCCCACAGGCCTGGTGGATGAAGACACCTT
CAAACTCATTTATTCCCAGTTCTTCCCTCAGGGAGATGCCACCACCTATGCACACTTCCTCTTCAATGCCTTCGATGCTG
ATGGGAACGGGGCCATCCACTTTGAGGACTTTGTGGTTGGGCTCTCCATCCTGCTTCGAGGGACGGTCCATGAAAAGCTC
AAGTGGGCCTTCAATCTCTATGACATTAACAAGGATGGTTGCATCACCAAGGAGGAGATGCTGGCCATCATGAAGTCCAT
CTACGACATGATGGGCCGCCACACCTACCCCATCCTGCGGGAGGATGCACCCCTGGAGCATGTGGAGAGGTTCTTTCAAA
AAATGGACAGGAACCAGGATGGAGTGGTGACCATTGATGAATTTCTGGAGACTTGTCAGAAGGATGAAAACATCATGAAC
TCCATGCAGCTGTTTGAGAACGTCATCTAGGACATGTGGGAGGGGACCCCGGTGGTCATTGCTTCTCAACCCAGAGAAGC
CTCAATCCTGACAGGAGAAGCCTCTATGAGAAACATTTTTCTAATATATTTGCAAAAAGTG
Sequence Type mRNA
Unitrap ID UNI13381

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127283966..127291714 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079056 (Kcnip3) NM_019789 Kv channel interacting protein 3, calsenilin Gene [Source:MGI (curated);Acc:Kcnip3-001]

 
Come back to gene ENSMUSG00000079056


For any suggestions or comments, please send an email to unitrap@crg.es