Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13549E10
Clone ID IST13549E10
Vector VICTR74
Project tigm

Sequence tag IST13549E10BBF1
Sequence
CTGTAGTCAGACGGGCCCAGTGTCAGGTTCTGGTTCTGTTCTCTAAATATCTAGAGGAGCTGTGTGACTTGGAGCCTCTG
CTCAGGTCTTCTTGTGTGTCACAAAGAAAACAGGAAGTANTATGTCATGGAGTTTTGTCCCTCTTTCCCTTCCTAGCCTA
ACACTTTGGATGTGATCNATCNNTTGANATGTACTGCTCTTTGGGGGCNANTGAGTATGCTCACCTNNNGCNGGCNTGCT
CNANGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13549E10HMR1
Sequence
ACAGAAGCTGAGGTTTCCCTTCTCTTTTGGTGCTGAGGTATTGCTACGCCTATACTTCCAGCGCAAAGTCTATTTTCTGT
CTCGTTCCATTTTTCAGTAACATCAGACTTCTTTGGAGTCTATACACTAATATAGATATACATATAGACTGTTAGCTTTT
TAAAAAATTATCTTTTATTATGTGTGTATGGAGGTCAGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55703722..55703924 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST13549E10HMF1
Sequence
CTGTAGTCNNACGGGCCCANTGTCAGGTTCTGGTTCTGTTCTCTAAATATCTAGAGGAGCTGTGTGACTTGGAGCCTCTG
CTCAGGTCTTCTTGTGTGTCACAAAGAAAACAGGAANTANTATGTCATGGAGTTTTGTCCCTCTTTCCCTTCCTANCCTA
ACACTTTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55703921..55704087 155
NO GENE  

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es