Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14649H12
Clone ID IST14649H12
Vector VICTR74
Project tigm

Sequence tag IST14649H12HMR1
Sequence
CTTTAACTCTGGGTAAAGTTGGATTATNAACTCAAACTTGTGCAAGGGAAGAGGCTGGTATCATGAGGAGAGAAGAGGGT
TC
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443586..180443666 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


Sequence tag IST14649H12BBF1
Sequence
AAAGTAAGTGCTACAAAGTTTGTCNATACCAACCTGGATAGCTTCGGGTANAGCTATGNNGTTAANANACTGCCACTGTG
GTCATTGTGTCTGACAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14649H12HMF1
Sequence
AAAGTAAGTGCTACAAAGTTTGTCGATACCAACCTGGATAGCTTCGGGTAGAGCTATGGAGTTAAGAGACTGCCACTGTG
GTCATTGTGTCTGACAGATCTGCTAAACTGGTCTTATTTTCAGTGACTCAATGAGAAGTTGCTTTCCCTGGACAGTTCAT
CTTTAAACAAGCACACCCAAACATCTCAGGGCGGACGGACCAACATTCCTTCCAGAAGCATTCCAGAATTTCTTTACATT
ACAATGACTGAATTTGCATTCACCTCCGGTAGACAATGGACACATAAATATGCAAATACCCATTTAACCGTTCCTATCCG
GCAGTGTTAAAGAGCCTCCAACTTCCCCCATCCCTTACCGGAATATCTAACCCATAACAAGGCATTGGGTAAACANGANT
CGGGGTTGGGAGGAATNNGGGTCCCTTCTCCGGCGGCAGAAATCCCCTCCGCCGAAGTTNANANCTGGGTCCNCACCATA
CNCCGCTAANAAAAAAGANNCTCACTGTGAGCNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180443663..180444178 490
 
EST/CDNA Est Name
  CA327345.1 - BI653462.1 - CF167818.1 - CD538654.1 - AI549786.1 - AA427046.1

 
Come back to gene CA327345.1 - BI653462.1 - CF167818.1 - CD538654.1 - AI549786.1 - AA427046.1


For any suggestions or comments, please send an email to unitrap@crg.es