Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14168H2
Clone ID IST14168H2
Vector VICTR74
Project tigm

Sequence tag IST14168H2BBF1
Sequence
CTCATCTGTTNNTNNGCTGATGGACATTAANANNNANNTTATTTTTTTCTTAGTTTTGTTTTGTGACAGGGATCTCTATG
TATCCCAGGCTGTTCTGGAACTTGCTCTATAGACCAGGCTGGCCTCAGACTCACATAGATACTCTTGCCTCTGTCTCCCA
AGTGCTGGGATTAAAGGTGAACACTAAAGGTGTGCACCAGCAATGCTGGGCATATTCTTCTCATTTGTATAGGAAGTTTT
CAATTCATAACCCATGAGTCTGTGGCCTGTCACCTGTTTTCAGTTGACTCAAATGATGCGGGCACGTGTGTATATAGTAT
AGTATAGTATAGTATAGTATAGTATAGTATANATGTTCAGGACATANNCNNTNANNTAAAATGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14168H2HMF1
Sequence
ACTCATCTGTTCATTTGCTGATGGACATTAANANNNANTTTATTTTTTTCTTAGTTTTGTTTTGTGACAGGGATCTCTAT
GTATCCCAGGCTGTTCTGGAACTTGCTCTATANACCAGGCTGGCCTCANACTCACATAGATACTCTTGCCTCTGTCTCCC
AAGTGCTGGGATTAAAGGTGAACACTAAAGGTGTGCACCAGCAATGCTGGGCATATTCTTCTCATTTGTATAGGAAGTTT
TCAATTCATAACCCATGAGTCTGTGGCCTGTCACCTGTTTTCANTTC
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69501283..69501568 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST14168H2HMR1
Sequence
GAAGTATGGTAGGAGGGCGCAGACGGGAGGTATAGACCCCGGCATGGGAGGGCGGCCGGGGCCGGACAGACTAGTGGAGT
CTGGATAATTCGGCCAGAGGGTGGCCGGACCCCAAGATGGTGAACTACGTGTATGACTCTGCCATTCCTGTGCTGACTCT
CTCGCTGCAGGAGACGCGGTTGTACCGGTTGCCAACTGTGGAGTGCGAGAATACAATTCAAACCCCAAGGAGCACATGTC
CTTCCGCGACTATATCANTTACTGGAAGGACTACNTCCAAGGGAGTTACTCCTCTTCGCGGGGCTGCCTCTACCTCAAGG
ACTGGCATCTGTGCAGGTAATAANACNGGACGGCGCATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59264007..59264366 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036819 (Jmjd4) NM_178659 jumonji domain containing 4 Gene [Source:MGI (curated);Acc:Jmjd4-002]

 
Come back to gene ENSMUSG00000036819


For any suggestions or comments, please send an email to unitrap@crg.es