Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14426E7
Clone ID IST14426E7
Vector VICTR74
Project tigm

Sequence tag IST14426E7HMF1
Sequence
CAGCCTACTTATTGCGCACGGAGGGAGATCTTCCTGGGCCGTTAAGACCTCTCCTCCATCCCCTCCCGGCCCCCGAGACC
CAGGTATCAACACAACTCCCCCTGCTGGGCCCCGACCCCCTCCGGGCCCGATTCCCGGAGTCCGCCAGCCTCCTCCTGCT
CCACTCCCCCGCGGTCAGGCTTTCCGCCGGCCGCCCAGATGCAGGCCCTTGTTCCTCCGACTCCATTTCAGCCNGGCCCC
CGNNNNNNCGGCTGGAACTTTCAAGCACCTCTGTCCACTTACCTCATGGCTCGCTTAATCCTGAACAATGGAGGCCACAC
AACCGCTCTTCGCTGGGAANANCTANGCTGGCTGANAAACGTCTGGCCGGCGTGTCCNAACAAACGCCTGCNCNATANGC
TCCCGCCTCACTCCGTCCCGCGCGTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280023..90280449 397
 
EST/CDNA Est Name
  AW061145.1 - AW244608.1


Sequence tag IST14426E7HMR1
Sequence
GGCTGGAGCGTTGCGCAATTTTCTGGTACCTAGTGTTTGACCNATAGTACATGCCTCGTAACTGTTAATGCTGTATTAAT
AAATGATAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI6854

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90280445..90280536 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001016 (Ilf2) NM_026374 interleukin enhancer binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1915031]


Sequence tag IST14426E7BBF1
Sequence
CAGCCTACTTATTGCGCACGGAGGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001016


For any suggestions or comments, please send an email to unitrap@crg.es