Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12340E2
Clone ID IST12340E2
Vector VICTR76
Project tigm

Sequence tag IST12340E2HMF1
Sequence
CTCTAACCTCTTATATTTTAATATTTCTAAGATTATGTATAGTGGGGCAGGGTGTAGTGGGCTTGGAATCTAAAGGAAGT
ATCTTGCCAAGGTCTTATGGTCTCCTTTCCGCCTTTGATTGCTCTATTATCATGGACCTAGCTATCTGCTGAATAGTTCA
GTTTATTTTGTTGCCTTGACAACATTTCAAGGTCTCCTATAAATCACCACAGTCACTATGCTCTGTGGTGTTGATCATGT
CAAGCCAGAGAGAAACAGCCATCCCTCAGGGCTATAATATTCAGATAAAAGAGGAGAACAGGGCTAGAGAGATGGTTCAG
TGGTTAAGATTGCTCTAACAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTTAAATGGGAT
CTGATGCCCTCTTTCAGTATTCGATACAGCTACAGTGTACTGGCATATATAAAATAAATNAGTCTTTAAAAAAAAANGGN
NGG
Sequence Type genomic DNA
Unitrap ID UNI11186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88801397..88801875 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es