Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14161H9
Clone ID IST14161H9
Vector VICTR74
Project tigm

Sequence tag IST14161H9HMF1
Sequence
ATCCCACTTCATTCTANCAGAAGCAACCTTACTGTGGTCATTCTCAAAACAGACCNCANAACGTCGAGCCTCAGTAAACC
ATGACTCTTCACAAAAGTGTCATTTCAGACAGGGATAACTTAAATCATCCTCAGCTCAACCAGCAAGAGGCCCCCCAAAC
CCCCCAGTGCCAACCCAACTCATTTTTGGAAATCCGGTTCTGGCAACCACGTTGAGTTGCAGAACGACACTCTATAGCCC
CAAATTACACCGGCACAGACCCTCTTCTGGACTTGTTTGGAACCCTTACCGACACGGGCTGCAGANGGCTCAACGCGCAT
TCTTCTGGCTGAACTTGAGAACTATGTCTGANGCAGATGCCCACCATCTACCTATGCCTTCTGACGGGTGGACCACACCG
AGCCCGTTGGCTTTCNNGATCCAGCCNTTACTTCTGAGACGGAACCTGCATCTTGTCTCCCGAGTGCCAAAAGGCAATGC
CTTCGGGGAAGGAGAANTTATGCCGCNTTANANCTAACGGCTTTNANTTTTNNATCCCNTTNATGANAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116533412..116533958 507
 
EST/CDNA Est Name
  BM934251.1


Sequence tag IST14161H9HMR1
Sequence
GGATCTCTTTATTACTCCTTCNGACGGAGGTGTTGTCTCCAGGAAGCATCATGGAAAGGCGTGGTGGTGCACAAGGGCCT
TCAGGATGCCTGCGCCTGGTAAGAGCTTCATAGAGTCGCAGGGGTTGTGGTAGCTGGGAAGGGTTGGTTGTTAGGTTTGG
GGTGGNGNTGNNGN
Sequence Type genomic DNA
Unitrap ID UNI26364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116533955..116534124 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020812 (1810032O08Rik) RIKEN cDNA 1810032O08 gene Gene [Source:MGI Symbol;Acc:MGI:1913543]


Sequence tag IST14161H9BBF1
Sequence
ATCCCACTTCATTCTAACAGAAGCAACCTTACTGTGGTCATTCTCAAAACAGACCTCAAAACGTCGAGCCTCAGTAAACC
ATGACTCTTCACAAAAGTGTCATTTCAGACAGGGATAACTTAAATCATCCTCAGCTCAACCAGCAAGAGGCCCCCCAAAC
CCCCCAGTGCCAACCCAACTCATTTTTGGAAATCCGGTTCTGGCAACCACGTTGAGTTGCAGAACGACACTCTATAGCCC
CAAATTACACCGGCACAGACCCTCTTCTGGACTTGTTTGGAACCCTTACCGACACGGGCTGCAGAGGGCTCAACGCGCAT
TCTTCTGGCTGAACTTGAGAACTATGTCTGAGGCAGATGCCCACCATCTACCTATGCCTTCTGACGGGTGGACCACACCG
AGCCCGTTGGCTTTCANGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116533537..116533958 420
NO GENE  

 
Come back to gene ENSMUSG00000020812


For any suggestions or comments, please send an email to unitrap@crg.es