Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_282B07-3
Clone ID CMHD-GT_282B07-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_282B07-3
Sequence
GTCTAGCATGGTATCTCCCCGACCTCCAGGAATTAACAAAAAACCGAAAAAAAAGAATCTGAATGGGGTGAACTATCCCT
GGTACGGCAATACCACGGAAACCTGCACGATTGTGGGGCCCACCAAGAGGGACTCCAAGTTCATCATCAGCATGAACGAT
AACTTCTACCCCAGCGTCACGTGGGCCGTGCCCGTCAGTGAGAGCAACGTGGCCAAACTGACCAACATCTACCGGGACCA
GAGCTTCACCACGTGGCTGGTGGCCACCAACACCTCCACCAATGATATGATCATCCTGCAGACCCTGCACTGGCGCATGC
AGCTGAACATCGAGGTGAATCCCAACCGGCCCCTGGGCCAGCGCGCCAGGCTGCGGGAGCCCATTGCCCAGGACCAGCCT
AAAATCCTTAGCAAGAATGAGCCCATCCCGCCCAGTGCCCTGGTCAAGCCCAACGCCAACGATGCACAGGTCCTCATGTG
GAGACCCAAGTACGGGCAGCCACTGGTGGGTGATCCCGCCCAAGCACCGGTAACAGCCAGGCTGCTGCGAGGTGAGACTC
AACGTAGTAACAATATTACTGCTCAGAAGGAAACCCAGATGCCCTGTCGGTCATTCAGAAAAATACAACCATTCTACCTT
Sequence Type mRNA
Unitrap ID UNI13193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31924658..31925293 586
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050592 (A130092J06Rik) NM_175511 RIKEN cDNA A130092J06 gene Gene [Source:MGI Symbol;Acc:MGI:2443569]

 
Come back to gene ENSMUSG00000050592


For any suggestions or comments, please send an email to unitrap@crg.es