Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11295D1
Clone ID IST11295D1
Vector VICTR76
Project tigm

Sequence tag IST11295D1BBF1
Sequence
TTANCAACCACATGGTGGCTCACAACCATCCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32513 UNI32514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101153558..101153600 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 69671685..69671727 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26012860..26012902 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037437 (Adam32) NM_153397 a disintegrin and metallopeptidase domain 32 Gene [Source:MGI (curated);Acc:Adam32-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112175740..112175782 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027130 (Slc12a6) NM_133649 solute carrier family 12, member 6 Gene [Source:MGI (curated);Acc:Slc12a6-001]


Sequence tag IST11295D1HMF1
Sequence
TTANCAACCACATGGTGGCTCACAACCATCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGT
GTACTTACATATAATAATAAATAAATCTTAAAAAAATGCATAATAAATGAAAAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027130


For any suggestions or comments, please send an email to unitrap@crg.es