Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11526C6
Clone ID IST11526C6
Vector VICTR76
Project tigm

Sequence tag IST11526C6HMF1
Sequence
AAGAAAATTACATTTGGAGCGTTCAGGCCCACAGACCTAGTAATTGTGGGAGGAGAAGGAGTCTCCTGACCNGGACAGAG
AGCCCATTCTCAGTAATGGGCCGGTGAGGAAACTTANNCTATACTTAACTGGAGTCCTTTTGACCTGAGGGAGGTGGATC
CAAGTCTTATGATGCCCTGAANCCTACATGATTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53712825..53713025 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]


Sequence tag IST11526C6BBF1
Sequence
NAAGAAAATNACATTTGGAGCGTTCAGGCCCACNNACNTNNTAATTGTGGGAGGAGAAGGAGTCTCCTGACCAGGACAGA
GAGCCCATTCTCAGTAATGGGCCGGTGAGGAAACTTANNCTATACTTAACTGGAGTCCTTTTGACCTGAGGGAGGTGGAT
CT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11526C6HMR1
Sequence
CTTTTAAGTTCCTAACTTCAGCTTCTGTCTGCAGTCTCTATCTGTCCCAGCAGATTGCTGTTTGACCGACGCCATCCATG
AATCAGCTGCTGACTACAGCCTGCTCATGAGCCCTGGACTTGCTGAGAGCTGATGAGAACTGATGGGATTGTTCTCTGTC
CCTTCAGGGGTCANCAAACCANATGCTCCTGATAAATGTCCCATTGCCTGAATTTCCTGGTGACCTTGACTAGCACTCCA
GCCTTCCTANGCCCTGATAATGACTTCCTAATTCCANCANGAAATANTTACACAAAAAAGTATGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53712523..53712827 293
NO GENE  

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es