Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13740G7
Clone ID IST13740G7
Vector VICTR74
Project tigm

Sequence tag IST13740G7BBF1
Sequence
GCTGCACCCAAGGCCACCCCCAGAATCATGCGCTGCGCTCCGACAGCAGGCGCTGCCCTGGTGCTATGCGCGGCTACTGC
GGGGCTTTTGAGCGCGCAAGGGCGCCCTGCACAGCCAGAGCCACCGCGCTTTGCATCCTGGGACGAGATGAACTTGCTGG
CTCACGGGCTGCTACAGCTCGGCCATGGGCTGCGCGAACACGTGGAGCGCACCCGTGGGCAGCTGGGCGCGCTGGAGCGC
CGCATGGCTGCCTGTGGTAACGCTTGTCAGGGGCCCAAGGGAAAAGATGCACCCTTCAAAGACTCCGAGGATAGAGTCCC
TGAAGGCCAGACTCCTGANACTCTGCAGANTTTGCAGGTAGGCNCATCTACTAGGACTCTGACTCNACTTANACTANCGA
GTCTAGTACTCCNNGACCTGGGTGGAGAANGGCCCTCAGNNCAGACTGTGAAANNGN
Sequence Type genomic DNA
Unitrap ID UNI33603

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33917913..33918364 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002289 (Angptl4) NM_020581 angiopoietin-like 4 Gene [Source:MGI Symbol;Acc:MGI:1888999]


Sequence tag IST13740G7HMF1
Sequence
NCTGCNCCCNNGGCCNCCCCCANAATCATGCNCTGCGCTCCGACAGCAGGCGCTGCCCTGGTGCTATGCNCGGCTACTGC
GGGGCTTTTGAGCGCGCAAGGGCGCCCTGCACAGCCANAGCCACCGCGCTTTGCATCCTGGGACGAGATGAACTTGCTGG
CTCACGGGCTGCTACAGCTCGGCCATGGGCTGCGCGAACACGTGGAGCGCACCCGTGGGCANCTGGGCGCGCTGGAGCGC
CGCATGGCTGCCTGTGGTAACGCTTGTCAGGGGCCCANGGGAAAANATGCACCCTTCAAAGACTCCGANGATANAGTCCC
TGANGGCCNNACTCCTGANACTCTGCANANTTTGCAGGTAGGCNCATCTNCNANGACTCTGANTCTACTTNNACTAACGA
GTCTAGTACTCNAGGANCTGGGTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000002289


For any suggestions or comments, please send an email to unitrap@crg.es