Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12329G12
Clone ID IST12329G12
Vector VICTR76
Project tigm

Sequence tag IST12329G12BBF1
Sequence
GTGCCCAGCAGCCCCAGCCTTATGTGATGGTGTTATCCAGTTCAAACGGGTTTTCCTCTCAGGTAGCCGTCAAACAGAAT
GAACTGCTAGAGCCCAACTCTTTTTAATACACCAAAGGAATTATGGGTGGGTATTTTTTTAATTGAACTCATTTTTCGGT
TGTCTGACCATAACATGATTTTTTTCTAAGATGAAATCCACAGAAGTTCTTAACTGTTAAAAAGTTACTTTTGACTTTGC
TAGATAAGA
Sequence Type genomic DNA
Unitrap ID UNI9170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79980471..79980718 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]


Sequence tag IST12329G12HMF2
Sequence
AGACTCTTGCGACTTTTTCTCGGGAGAGTTGAGATTGTCTCAGGAAGGAAAGAGAGAAGATCCCTAAACAGCTGCCCCTT
TCAGTCTGCAGCCCTTTGTAAGCCATGCCCTTTCTCAGGCCATGTTCTCAGCCCACACCCAACCTCTTTGGAGTCTTGAC
TCCAATGATGCTAAGTCTCTCAGCCTTCACCCAGTCAAGACCTTTCTCCTTTCTTCCTTGGGAGTCCCGAAGTCCATCTT
GTCATCCTATGTCTAGGGTTTCCCAAGGGGTCGATTATTCCAGATGCCTGAATCTAGAATACTGTATGGTGCTTAAATCC
CTCAACTACCCATTCAATTTCCAAGATGGTCCATAAACATTGCTTCANTTCAGGGAAGAATTCNAGATTCCTGAATTGTT
CAACTCTTTCCCTCANANCCTCCCAAGGCACATGTGACCCATCACCNNANANCTGAAGGTGAAGTCNCCCTGAGGTGCTG
GGCNNTGGGCTTCTACCCTGCTNACATCATCCTGANNTGGCAGTGGGANGANGN
Sequence Type genomic DNA
Unitrap ID UNI9935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37124761..37125291 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es