Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14190F5
Clone ID IST14190F5
Vector VICTR74
Project tigm

Sequence tag IST14190F5HMF1
Sequence
TGGGTAGTCNTANTAATCTTAGTGAATGCTACATTTCTGTTTTAACCACAGGTTTACATGTAAGTACTACTAACACTTCA
TTCGAGGTGCTGCATCTTAATTCCAAACCATCCTCTCTGTTCCAGCGCTGACTTCTTTTTTCCAATGTGCTTCTAAAGCC
TACGGCCAACATCCAACTTCTCCCAAACTCTACCTAGATCCTCGATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471144..59471354 207
NO GENE  


Sequence tag IST14190F5HMR1
Sequence
CCAAACGTTAANAATGTGGGACAGGAGAAAGCCTTGCCTTCCCAGGCCCCATTGTACTGTTCAGCTGTTTTCTTTTACAT
TTGTATTTTTTAAAGAGTTGGAGGAAATACTGTAAAGAGATGATTAATGTTGCACATTATCAGGTGAGCTGGAAACCAAG
AGCATAACTTAAAAATAACCTGCGCTGCANCCTGTGATGCTATTATGCATAATTCTAGGTTACTTCATGCTCTGACANTA
ATACCATTCGTGGGGGGGAGGGGTCAGCTTCCACCTTTTACATACATTATTTCANTCNNAATTAATCNTGCCTCCNNCTG
TGCTCCNNGCAATTAAAATATTTTAANANNTAN
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471352..59471697 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST14190F5BBF1
Sequence
NGNNNNGTCTTATTAATCTTAGTGAATGCTACATTTCTGTTTTAACCACAGGTTTACATGTAAGTACTACTAACACTTCA
TTCGAGGTGCTGCATCTTAATTCCAAACCATCCTCTCTGTTCCAGCGCTGACTTCTTTTTTCCAATGTGCTTCTAAAGCC
TACGGCCAACATCCAACTTCTCCCAAACTCTACCTAGATCCTCGATGGCCAAGATCCAACTTCCCTACCGAGATCCCTCT
ACTCCTCATGCTCCCAGAGAGGGGTCTATTCTGTTCCTTCACACTGGTGTCCCCCTCACCATTATTTACACANAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471036..59471348 311
NO GENE  

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es