Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14546B4
Clone ID IST14546B4
Vector VICTR74
Project tigm

Sequence tag IST14546B4BBF1
Sequence
TTACCATGCTTACATCAGCTAAAATATNNNNAAAAACACCAAGACNNCNNNCNANACCCCTAATACANGNAANANGNCCT
CTAACATCCACNANNANACAGAGGCCATGNANNCCCACCCACATAGACACAAATACTNNAAATACTTAAAAANANTNNAA
ACAAAACACAATAATATAGAATAGGGATATTGCTCAATGATAAAACANNNGCCTAAAATGCTTAAAGCCCTGNNNNNNAT
CTACAGATATACTCATGCAGACACANNNNNATATATATAAATAAAATATTAAGGGAAACTGGCACAGTAGTAACATTGGC
TCTGCAAACATAAGAACCTTAATGAAATCCCCAGTACCCATGGAAAAGGCCAGCCNTGGCCGTGTGTGCCTGAAGTCCCA
TNACTGGANGACTGGGACAGAAAGATCCAGAATAGCAAGGGTCTGGTTTTATTGAGACCTTGTCTCAAANGCAAAAAGCC
NTGGAATGTCTTACTCTANCTAGTGCATGGGCANANCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14546B4HMR1
Sequence
TAAAATAGTAGTCNCTTAAATCTGTATGATAGAGGACTTCATGGGATTACTCTACTTTTATTGTTTGTCTGTTTCANNNN
NTTTCCCATGTAGATTTAATAATCAGTTTGTCACTGTCTTATGTTTTATACTGTAATGCATGGCCCACTTGTAAATAGAA
AGTTCTCTCTGTAGTGTACTGTGGGCCTGAGTACCAGAGGCTTTCCATGGAAAT
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101495555..101495767 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


Sequence tag IST14546B4HMF1
Sequence
TTACCATGCTTACATCAGCTAAAATATTTTTAAAAACACCAAGACTTCATTCCATTCCCCTAATACATGTAAGTTGTCCT
CTAACATCCACAAGTAGACAGAGGCCATGTATTCCCACCCACATAGACACAAATACTTTAAATACTTAAAAAGTTTCAAA
ACAAAACACAATAATATAGAATAGGGATATTGCTCAATGATAAAACACTTGCCTAAAATGCTTAAAGCCCTGGGTTCAAT
CTACAGATATACTCATGCAGACACACGTGCATATATATAAATAAAATATTAAGGGAAACTGGCACAGTAGTAACATTGGC
TCTGCAAACATAAGAACCTTAATGAAATCCCCAGTACCCATGGAAAAGGCCAGCCATGGCCGTGTGTGCCTGAANTCCCA
TCACTGGANGACTGGGACANAAAGATCCANAATAGCANGGGTCTGGTTTTANTGAGACNTNGNNTNANANGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101495765..101496237 447
 
EST/CDNA Est Name
  CK129187.1 - BG694960.1 - CK780373.1 - BY736599.1 - BF122759.1 - BG865026.1 - BF161117.1 - CD771230.1 - CD363766.1 - CN672700.1 - CX122849.1 - BE303202.1 - CB566095.1 - CB236616.1 - CF616843.1 - CF158370.1 - CA537307.1 - CA548709.1 - BY738591.1 - BI697505

 
Come back to gene CK129187.1 - BG694960.1 - CK780373.1 - BY736599.1 - BF122759.1 - BG865026.1 - BF161117.1 - CD771230.1 - CD363766.1 - CN672700.1 - CX122849.1 - BE303202.1 - CB566095.1 - CB236616.1 - CF616843.1 - CF158370.1 - CA537307.1 - CA548709.1 - BY738591.1 - BI697505


For any suggestions or comments, please send an email to unitrap@crg.es