Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12712A9
Clone ID IST12712A9
Vector VICTR76
Project tigm

Sequence tag IST12712A9BBF2
Sequence
GCAGTGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACANAGTGANTTCCAN
Sequence Type genomic DNA
Unitrap ID UNI33608 UNI33609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41462267..41462323 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 84717408..84717464 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81356078..81356134 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 92534792..92534848 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13473054..13473110 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031925 (Maml2) NP_001013835 mastermind like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2389460]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97593325..97593381 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031786 (Ccdc135) NM_001042715 coiled-coil domain containing 135 Gene [Source:MGI Symbol;Acc:MGI:2685616]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 128619803..128619859 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136602858..136602914 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 40097135..40097191 53
NO GENE  


Sequence tag IST12712A9HMF1
Sequence
GCAGTGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGANA
AACCCTGTCTCGAAAAAACANACNNNCCAACAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031786


For any suggestions or comments, please send an email to unitrap@crg.es