Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14569G2
Clone ID IST14569G2
Vector VICTR74
Project tigm

Sequence tag IST14569G2BBF1
Sequence
NGANCCCTGCATGCAGTGGCGTTAGGTTACAGAGGCAGAACCGCAAGCTACAGCAGACGTCTCTCTCTGCCCTTCCAGAA
TGCTCTGTAGAAGGAGACGGCTCTTTTCCCTCCCTCCTTCCCACTGCTTTCTCTTTTTCTCTGAGCAGCTGTTGTCTTGT
GAACCTCTAAAAGCTACACCTCTTTACACCTCTGTAGGTTCTCTGCAGAATAAACGCTCTTGGCCTTTGCTCACTATTTG
AGTCTTGGTTATCATTTCTCTTGAATAAATCACAGACCCTTACCGTTGGACAGTGCCAACTTTAACTCAGAAGGCCTGTG
TCAAGTCCATGTGTGAGAATAGATTTGCTCCCATACTTGTTGATTCTAGGCATTCCACTGCAAATCCTGTTGAGTGTGTG
TGTATAGCATTCCATTGTGTGTGTATGCATGTGTATAGAGGTCAATGGTCAATTTTAGATAATTTGATTCCCTANTACTG
GTNCCNAAAATGAGTGCTACCTTTTCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4768970..4769474 497
NO GENE  


Sequence tag IST14569G2HMF2
Sequence
ACAGCTTTTGTTATACTTACTACACATTATCTACCTTCTTGTCCCTGACAATCTCATACTGCTCCAACTTTAAAGGAGTT
CTCAGAATCTCCAAACAACTTATCTAATCCCCTTCACTTCTTGACCATTCCATTCGAGCTAGAGGGGACAGGTCACCAGG
CAGGTAGGCCGGCTGTAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155078491..155078671 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es