Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14575D8
Clone ID IST14575D8
Vector VICTR74
Project tigm

Sequence tag IST14575D8BBF1
Sequence
CTGGAACGTGTGGGTGTGGGGAAAGTGGGACTCGGGTTAAGGTCACCAGGTCAGAAGCCAGTGAGAACCTTGGAGAATAA
AAACTCCCCTGAGCGGGCTGGAGCCGCGCGTGCCTAGCATGAGCCCGCCCATGGGTTTGACTGGCACCCAGAACCCCTCC
CGCAAAAGGACACTAAAGAGCACTGGCTGCTCTTTCCGAGAACTGAGGTTTGATTTCTAGCACCCACATAGTGGCTCACA
ACCACCTATAACTCTAGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916319..30916581 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14575D8HMF1
Sequence
CTGGAACGTGTGGGTGTGGGGAAAGTGGGACTCGGGTTAAGGTCACCAGGTCAGAAGCCAGTGAGAACCTTGGAGAATAA
AAACTCCCCTGAGCGGGCTGGAGCCGCGCGTGCCTAGCATGAGCCCGCCCATGGGTTTGACTGGCACCCAGAACCCCTCC
CGCAAAAGGACACTAAAGAGCACTGGCTGCTCTTTCCGAGAACTGAGGTTTGATTTCTAGCACCCACATAGTGGCTCACA
ACCACCTATAACTCTAGGGGATCCAATGCCTTCTTCTGGCCTCCTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916291..30916581 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14575D8HMR1
Sequence
NNGTCTTGCTGGGCAGGCCNAGGGGACAGTCCTGGTGGCTTCCTTTATTTTCTTCCCTATTCATGAGCAAATGTCACCAA
ATATTTCCAAGTGTTTCCTTATTCCCTGGGGCTTTTCGGTCCAGTATGGCCGGAGTCTTCTCAGCTAACCCANGCAGGTT
TCANCCACCACCTTTTTCCCCTTCGCTGGCAGCCTGGCTGCTCCTCCTNCCATATGTTCNNCTAACCTGGGAGGGTTTCN
NCCACCACCTTCTTCCCCTTTGCGGGCGAGGAGGCCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30916581..30916859 259
 
EST/CDNA Est Name
  BY090554.1

 
Come back to gene BY090554.1


For any suggestions or comments, please send an email to unitrap@crg.es