Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_314G04-3
Clone ID CMHD-GT_314G04-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_314G04-3
Sequence
ATCATCCCCGTTACTGGACCAATCCAAGGAGGGCTGCAGGAGGGACTTCAGGTGACCCTCCAGGGGACTACCAAGAGTTT
TGCACAAAGGTTTGTGGTGAACTTTCAAAACAGCTTCAATGGAAATGACATTGCCTTCCACTTCAACCCCCGGTTTGAGG
AAGGAGGGTATGTGGTTTGCAACACGAAGCAGAACGGACAGTGGGGTCCTGAGGAGAGAAAGATGCAGATGCCCTTCCAG
AAGGGGATGCCCTTTGAGCTTTGCTTCCTGGTGCAAAGGTCAAAGTTCAAGGTGATGGTGAACAAGAAATTCTTTGTGCA
GTACCAACACCGCGTACCCTACCACCTCGTGGGACACCATCGCTGTCTCCGGCTGCTTGAAGCTGTCCTTTATCACCTTC
CAAACTCAAAACTTTCGTCCTGCCCACCAGGCACCCATGGCTCAAACTACCATCCATATGGTTCACAGCACCCCTGGACA
GATGTTCTCTACTCCTGGAATCCCTCCTGTGGTGTACCCCACCCCAGCCTATACCATACCTTTCTACACCCCCATTCCAA
ATGGGCTTTACCCGTCCAAGTCCATCATGATATCAGGCAATGTCTTGCCAGATGCTACAAGGTTCCATATCAACCTTCGC
TGTGGAGGTGACATTGCTTTCCACCTGAACCCCCGTTTCAATGAAAATGCTGTTGTCCGAAACACTCAAATCAACAACTC
CTGGGGGCAGGAAGAGCGAAGTCTGCTTGGGAGGATGCCCTTCAGTCGAGGCCAGAGCTTCTCGGTGTGGATCATATGTG
Sequence Type mRNA
Unitrap ID UNI13416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78777028..78790203 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es