Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14047B6
Clone ID IST14047B6
Vector VICTR74
Project tigm

Sequence tag IST14047B6HMR1
Sequence
CCCAACCNCTAGTCCCCTACAAGATCACTCCAGATATCTTACCCGTAGATGCCCCCTAATACCGTGGGATGGCTAACAGC
TCGATTTCATTAGTAAAGAACCTCTCAAGTGCCAGGGCCCCCCACGAATCCTTTCCCTGCCGCCTCATCAGCTTCCTCCA
CGAGATCCTCTGCTTGCCACCGGCTTGGCTGTGCTTACAGGGTAGCTGCTCCTGAACCCTCTGTTCCTATCTACTGTAGG
ATTGCTTCCAGGGGGTGTAGCATTAGTACTTTGTGACTAGGGTTGCCCCCTACTATGTCTGACCACACACAACCCACTCC
CCATGCCCTCTTTGTGGGTGCAAAAAATATTTTCTATTCTGGCCCATGCTAAAAGTGCGTTTTAAGGACCTTTTCCTGCA
ACTGACCCAAAAAGACCTCTTCAAATTCAACTCCCCCGCCCCCCCCCAGGGGGACAGCTCCCTCCANANTTTTTTAATAC
CATGGCCTTTTACCCGTTTANGGAGAAACATCTGCCTGGTTANCATCNNANTCTCATGAAANACTCCTGGCCCNCTTCCC
CCCCCTCCCCTCANCCTGGCTTNNGCNNTCCCAGGANANNGCNNGTTN
Sequence Type genomic DNA
Unitrap ID UNI29495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4972396..4973002 567
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074405 (6430526N21Rik) NM_001033383 RIKEN cDNA 6430526N21 gene Gene [Source:MGI Symbol;Acc:MGI:2442656]

 
Come back to gene ENSMUSG00000074405


For any suggestions or comments, please send an email to unitrap@crg.es