Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14100C7
Clone ID IST14100C7
Vector VICTR74
Project tigm

Sequence tag IST14100C7HMF1
Sequence
GGTTTCTCTGTATAGCCCTGGCTGTCCTGGCACA
Sequence Type genomic DNA
Unitrap ID UNI9937 UNI29633 UNI32242 UNI33441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 447228..447260 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 77844..77876 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45723135..45723167 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77437844..77437876 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025425 (St8sia5) NM_153124 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 Gene [Source:MGI (curated);Acc:St8sia5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9450515..9450547 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30117972..30118004 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 54159061..54159093 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21321551..21321583 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8092465..8092497 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69106808..69106840 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 16013043..16013075 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 34659131..34659163 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 70808697..70808729 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60613164..60613196 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 35009769..35009801 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29994639..29994671 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6703505..6703537 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 35340797..35340829 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 56248613..56248645 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 68955257..68955289 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59591809..59591841 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74463195..74463227 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026175 (Vil1) NM_009509 villin 1 Gene [Source:MGI Symbol;Acc:MGI:98930]

 
Come back to gene ENSMUSG00000026175


For any suggestions or comments, please send an email to unitrap@crg.es