Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13073G5
Clone ID IST13073G5
Vector VICTR76
Project tigm

Sequence tag IST13073G5BBF1
Sequence
TTGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACA
ACCATCCATAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI663 UNI33616

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66941860..66941958 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84944935..84945033 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6209200..6209298 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38313074..38313172 99
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92461366..92461464 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029403 (Cdkl2) NM_016912 cyclin-dependent kinase-like 2 (CDC2-related kinase) Gene [Source:MGI (curated);Acc:Cdkl2-001]

 
Come back to gene ENSMUSG00000029403


For any suggestions or comments, please send an email to unitrap@crg.es