Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14442C12
Clone ID IST14442C12
Vector VICTR74
Project tigm

Sequence tag IST14442C12HMR1
Sequence
CATGTATGTAGACAATGTACTGTAATGCCACATCGGTGTGTCATGTTACCGACAGAGCAGGGCTGAGGAACTGTTGGAAA
AATGGATGTTGAGTGGCATTTGAGAAGACCAGATCAAGCGTGAGCACTGGCCGACTCTGGAGCTGGGGTCAGCACATTTG
TTTGAGGTGTTGGAAGGGGCTGGAGAATCCTTGAGGAAAAGGGAGAGTGGTCCCAGGTTAGGCCAAAATGGGTAAGTANA
GACAGGTCAAGTAAAGTCTTGAAGAACTCACAAACNAANACTGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI8009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29902978..29903265 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039715 (Wdr34) NP_001008498 WD repeat domain 34 Gene [Source:MGI (curated);Acc:Wdr34-001]


Sequence tag IST14442C12BBF1
Sequence
CATGGCTTACTGTAATCCTTGCAACNACCGGGAAAGCAGCTATCTCCAGGTTCCCTGCTGATGAATCCCTAACACACCAG
TTGGTCAGCATCAGGCCTCCGTTATCTCATTATTTGTATGTTTTTGGGTTACACTAGAAAACCATAGCAGGGCAGTGGTG
AGAGAGGCCTTTAATTCCAGCAATCTCTGAGTTCAAGGCCAGCCTAGTTTCCAGAGCAAGTTTCAAGACATCCAGGGCAC
ACAGTGAAACTCATGTCTCACAAAAACAAAAGCAAACAAACAAACAAAAGAACAACAACAAAGGAACATAGAAAACCGTT
CAAGCTAGCCCTCAAGGTATCTGACCATTTCAAACACCAATAATGTCAAGTTGAAATGCCTAAAAACTGCTATTCACAAA
AAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29903262..29903678 415
 
EST/CDNA Est Name
  BQ832252.1 - AA472011.1 - CF894015.1 - CF897624.1 - BQ899939.1 - BQ555443.1 - BE569290.1 - CB193012.1 - CA495152.1 - BF152242.1 - CA491753.1 - BY289275.1 - BY105745.1 - AW762217.1 - BB844601.1 - BY236010.1 - BY101425.1 - BY119911.1 - CF577889.1 - BY005976

 
Come back to gene BQ832252.1 - AA472011.1 - CF894015.1 - CF897624.1 - BQ899939.1 - BQ555443.1 - BE569290.1 - CB193012.1 - CA495152.1 - BF152242.1 - CA491753.1 - BY289275.1 - BY105745.1 - AW762217.1 - BB844601.1 - BY236010.1 - BY101425.1 - BY119911.1 - CF577889.1 - BY005976


For any suggestions or comments, please send an email to unitrap@crg.es