Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13609B10
Clone ID IST13609B10
Vector VICTR74
Project tigm

Sequence tag IST13609B10HMF1
Sequence
CTACTGTTTAATTCTGGTTATCTGAGATAGAGTTAAGCTCATAGACAAATAAATAGAAGTATCTGGGGGTANGAGAAGGA
TTAAATATGTTTATGGGAACAGAATTTTGGTATAAAAGAAAAACATTTTAAAATTGTCCTAAAAAGAATTAAGAACTGAT
ACCTTTCCCCTAAATTGTGAAAAATATTANTCNATGTATCTAACAAACTCAAAACCCTGTGANTATNNTANCTGTNNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508147..108508381 221
NO GENE  


Sequence tag IST13609B10HMR1
Sequence
AGNTGTCTGTTTTTTGTTTTTGTTGTTGTTTTTTGAGACAGGGTTTCTCTCTATAGCCCTGGCTGTCCTGGAACTCACTC
TGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTACAGGCATGCGCCACCA
CACCCGGCTAGATGTCTGTTTTATTTGGATTGTTTTGCTTATGGTAATGTTTTCAAGGCTCCATGTTGTAGCATGGGCAT
GTTTCCCAGAGTTTGTTATTTTTAGACATTTCAAACAGGTTTCCTTTGTTCTTAGCTAAGTTACTGANACTTTAATCCCC
ATTTTCACTTTCTGTTTTTTTACTAAACTTTTATGGTCTCTTATTTATATAGTTTTACATATTCTTGAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508380..108508772 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST13609B10BBF1
Sequence
ATCTACTGTTTAATTCTGGTTATCTGAGATANAGTTAAGCTCATAGACAAATAAATAGAAGTATCTGGGGGTAGGAAAAG
GATTAAATATGTTTATGGGAACANAATTTTGGTATAAAAGAAAAACATTTTAAAATTGTCCTAAAAAGAATTAANAACTG
ATACCTTTCCCCTAAATTGTGAAAAATATTAATCTATGTATCTAACAAACTCAAAACCCTGTGAGTATAGTAACTGTAAN
CNNAATCACTGAAAATCANAAAGATAATCTTCNAACCAACAAGACAAGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508095..108508383 271
NO GENE  

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es