Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_314A07-3
Clone ID CMHD-GT_314A07-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_314A07-3
Sequence
AACGAAACAGATGAAAGCCAGATCCAGCTGGCAGGCGGAGATGTGGAGCTGCCTCGGGAGCTAGCCAAGATGATCGAGGA
GGATACGGAGGAAGAGGAGGATAAGGCCTCTGTGCTCGGGCAGCTGGCCAGCCTCCCTGGCCTAGACCTCAGCTCACTCA
AGGACAAAGCCCAGACTACACTAGGGGACCTCAAGCAATCAGCTGAGAAGTGCCATATCATGTGACCACTTCCCCCTGGA
TTCTCCTCTAGGATGGCCAGAGGGCTGGTCCACATGAGGGCTAAGAGAGTGAGTGTCTCAACTTCCGGATACCTCCAGTC
CATTTTGGACTCTGCTTTCCCTGCCCCAGCCTAGCCTGAGCCGTCTCGTCCATGTCCAGCTCTAGCTCTGGT
Sequence Type mRNA
Unitrap ID UNI13439

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57449877..57450268 392
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039714 (Cplx3) NM_146223 complexin 3 Gene [Source:MGI Symbol;Acc:MGI:2384571]

 
Come back to gene ENSMUSG00000039714


For any suggestions or comments, please send an email to unitrap@crg.es