Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11388D7
Clone ID IST11388D7
Vector VICTR76
Project tigm

Sequence tag IST11388D7HMF1
Sequence
AGTTCAAATCCTCAAACCCCANCANGGCTGTGTGTGTGATCCCNNGGCANNTATGGANAGATGGGCNTGCANCTGCNNAA
CCCTNNNTCGGCCANCNNGGGGGCGGATGGANCAAACAAGGCACTCCANNNNNACCAAAGCCTGTGGCTGCTGCTTTCNG
GATGCTCANNANGGGCTNACACNNNATTCCTCACNTNTGCTNNNCACCCCCACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11388D7HMR1
Sequence
AACTCAGAACCTAAGGCTTACACTGCAGGGGTGCTTTGCTCACTGAGGCATCTCCCCANCACAAGGGATTTTTAAAAATT
GTTACATTTTTATTTATTGGGGGAAGAGGGGTGTCAGAGGCTAACTTTCAGGAGTCAGGCTTGGCAGCAAGCACCTTTAA
CCTAGGAGCCCTCTTGCTGGGCCTANAAAAGGTTTATTTTTCCCTACTGTTATTTCTGACCTGAAGCTGTTTG
Sequence Type genomic DNA
Unitrap ID UNI12540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21591219..21591451 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es