Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12172E9
Clone ID IST12172E9
Vector VICTR76
Project tigm

Sequence tag IST12172E9BBR1
Sequence
GTTTCTGCCTGTGAGACTCCGGATACCCCTATTCATTATTAGTTTTCTGATATANCTCACAGACCTTANTCACATCCACA
TCTCCCAAGTTTGTTGCAATGGATATTTGAAAGGTTCCAGACAATGTAATTAGAGAAGAGGAAACGTGATTAGGTCTGGA
GATCCTGGGTACAGGAGCTTGTGAGGTTCCCACAAGTCAGTTCTTACTCATTTAAGTGTGGACTGTGGAAGCATGTACAG
TAATGTCTGGGCTAGTGCTGGTAGCTGGGGCAGGGCANCTTACTCANACCTGTTCCTTNNAATTCTTTTGGGCTTGGGCT
GGCTGTANCATTTTTTTCCCTGNATAGAGAGCATGTGGTAAGGCTANTTACNCN
Sequence Type genomic DNA
Unitrap ID UNI27186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12797575..12797945 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


Sequence tag IST12172E9HMR1
Sequence
AGACTAAGTCCTTTTCTCCCTTAAGAGGAGTTACTTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI10089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 114353773..114353813 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021144 (Mta1) NM_054081 metastasis associated 1 Gene [Source:MGI (curated);Acc:Mta1-001]


Sequence tag IST12172E9BBF1
Sequence
CTCTGTATTAGCAAGGTCCAAGAGGCCCACACGACGTCAAGAAAAATCCAGAAACTTGGAAGTCAGGATCTATTTTTAAC
TCTCTGAGGAACTATTTTTCTTCCTTCACCANGGTGGTGGAGGGTTACTAGGTTCCGGTGGAGTGACGTGTCCCTTTGCA
ATAAATACCGGCGCTCCGGGCTCTGCGTCAGGCATTCAGGCAGCGAGAGCANAGCAGCGTANAGCAGCACAGCTGANCTC
GTGAGGCAGGANACTCANCCCGAGGAAATCGCAGATAAGTTTTTAATTAAAAAGATTGAGCAGTAAAAAGAATTANNNCT
CTAANCTTAAGCTAATAGAGTAGCTTATCGAAATATTACTTANTCTTANTAATCTNNNAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021144


For any suggestions or comments, please send an email to unitrap@crg.es