Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10875A9
Clone ID IST10875A9
Vector VICTR76
Project tigm

Sequence tag IST10875A9HMF2
Sequence
GTGGTTATGAAAAACGTTATTTTTTCCNCCAACCTCAGTGCCATAAATAACCCACAATTTGGGCTGGAGAGATGGCTCAG
CAGGTAAGAGCATTAACTGCTCTTCCAAAGGTCATGAGTTCAACTCCCAGCAACCACATGGTGGCTCACAACCACCCCAA
TGAGATCTGATGTCCTCTTCTGGTGTGTCTGAAGTCAGCTACNGTGTACTTATGAATAATAATAAATAAATCTTAAAAAA
AAANNACCCCN

Sequence Type genomic DNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58092435..58092684 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]


Sequence tag IST10875A9BBF1
Sequence
GTGGTTATGAAAAACGTTATTTTTTNNNNAACCTCAGTGCCATAAATAACCCACAATTTGGGCTGGAGAGATGGCTCAGC
AGGTAAGAGCATTAACTGCTCTTCCAAAGGTCATGAGTTCAACTCCCAGCAACCACATGGTGGCTCACAACCACCCCAAT
GAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58092516..58092684 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]


Sequence tag IST10875A9HMR1
Sequence
ATGTATTTGTTTATAAAGGAGTGAAAGGGAAAATGCTTAGCTTGTTTCTGCCCTATTCTTTGACATCCTAGCTAGCAACA
TTCTGGAGGAACATCTGACAGACTGATCAGAATTTTCTGGCAACATGGCTAGCCTGAAACTTAGCATATAGACCCTGTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38546998..38547156 159
NO GENE  

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es