Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14192D2
Clone ID IST14192D2
Vector VICTR74
Project tigm

Sequence tag IST14192D2HMF1
Sequence
CCACCACTACCCAGCAAACAGCAGATTTTTTTTTAAAATGTTAAACACGGGCTGGAGCGGTGGCTGANCANTTANTANAG
CAATCTGTTCCGGTAGTANTTTATTTTTGTGCCCAGCACCCTGTTANATGACTCATAACTCCTGTAGTTCCAGTCCAAGG
GGGTCCAACACCTTTGGCCTCCTGAATATACGTGCATCTTGGGCACCTGCACGCATGTGCACAAGGCCACACACACACAA
AGGTAACTAAAAATACAAAATAATTTTAAAATATTAAAAACGTTCAAAAGCATTTTCNATAGGAAAACTAANTCATAGTA
AACTAANAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44122797..44123127 311
 
EST/CDNA Est Name
  AI226883.1 - AW475342.1 - AI791109.1 - AA510262.1 - BB838830.1 - AI789097.1 - CB954782.1 - CA564929.1 - BB839311.1 - BF322246.1 - BY033174.1 - CJ157375.1 - CJ158199.1 - BY031415.1 - CJ155159.1 - BB847310.1 - BY017256.1 - BY183742.1 - BG062330.2 - BY006367


Sequence tag IST14192D2HMR1
Sequence
GTGGCACACATCTTTAATCTCAGCACTCAGGAGGAAGAANCAGATAGATCTCTTGAGTTCAAGGCCNGCCTCTTCTACNG
AGTGAGATTTTTTTCCCCTTGCATAGTAAANAGAGCTAAATTGCTCATAATGATTATATTTTCTCTTTANATTGGCCTTA
AAATGTTTCTTTTTTTTTTTTNGA
Sequence Type genomic DNA
Unitrap ID UNI29730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44122620..44122800 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052459 (Atp6v1a) NM_007508 ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI (curated);Acc:Atp6v1a-001]

 
Come back to gene ENSMUSG00000052459


For any suggestions or comments, please send an email to unitrap@crg.es