Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10496A7
Clone ID IST10496A7
Vector VICTR76
Project tigm

Sequence tag IST10496A7BBF1
Sequence
GGACACCCTTACCTTCCTGCTGTCTCACTTTTATCTGTCCTCAGGCCCTACCCTGACAATGCAAGCTTGACTGCTGGAAT
AGTAGGCTAGAAAGAAGAGAAGTGGAGTTCAGCAGGAGACTAAAGGGAAGGCAGGAGTGGGGAAAAGCTGCTATTGGGTA
TCTAGGACCCCTATGTTCTGGCCTCTGGCTCCAGGCTTCTCTTCTGTACAATGCCACGTTGATATATCCAGCAGCTGTGA
CTCANGCCTGGCCTCTTGCCAGGCCCAGTGCCTCTGCTGGAGTAGTGTCTGGACATGTCAACAGGCCTCCTATCCTGTTC
TGGGCACCAGANCCCTACCANACTCTCCCTCNTCCTGGAATTAANACTTGCCTTTGTTTGTGGGGAAAGGCAACTGANAT
CCTGGTTGCTCTGGAAGCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI33032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88298801..88299225 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]


Sequence tag IST10496A7HMF1
Sequence
TTGTATACTACTAGGATATCCCTCCAGTCCATGTTATANTACTAAAAAAAAAAAACNNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 82681204..82681258 53
NO GENE  

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es