Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11001F3
Clone ID IST11001F3
Vector VICTR76
Project tigm

Sequence tag IST11001F3HMF1
Sequence
CCAGGCCCACCTAATCCAGGGGTAACACCNCCCATAGTGGGCTACCCCTCCCCCGCCCCAAGCAATCATTAATCAAGAGA
ATGCCCTGTAACCCTTTGGGCTTTTCTAAGTCTACCCCTGCTCCTGAATAACGACATGAAGACTTATGTATGCCTTGGCC
TTAAGCGAGGCTCGTTTTCTGATTAGTTTGCAACTTGTATCAACTCATTTTTATTATTCCTTGTCTGCCATGTGGTTGCT
TATCTTTCCTCAGNTNNATAAGTCCAACTTCCTCTGGGTGGTGAATCTCCTCACACCTGACTCTCAGACCTTCCACCTTC
TACTTNCTGCCTTTGCCNACAGGCCCTANGCTTTTTATCTTATCCTCANGCNAGGAANGCCANACACATCTTCACACAGT
GCATGTAAACNTGTCTATATGGNCCCTACANGCCAGTCTGATGGANACAATTCCCCANCCNAGANTTCTTCTTCCCAGTT
A

Sequence Type genomic DNA
Unitrap ID UNI27914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 172805795..172806274 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026659 (Dusp12) NM_023173 dual specificity phosphatase 12 Gene [Source:MGI Symbol;Acc:MGI:1890614]

 
Come back to gene ENSMUSG00000026659


For any suggestions or comments, please send an email to unitrap@crg.es