Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0425
Clone ID AY0425
Vector pGT0lxr
Project sanger

Sequence tag AY0425
Sequence
CAAAAAAGAGAAATAATTCTTGTGAGCGTTTGAATGAGGAGGCGTCGATCATCCAGAGCGTGGGCTACCGGAACCGTGTC
AGAAGGCTTCCCCAGGTCGAACCTGGAAATGCCACCTTG
Sequence Type mRNA
Unitrap ID UNI2041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101393334..101393452 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es