Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11492D8
Clone ID IST11492D8
Vector VICTR76
Project tigm

Sequence tag IST11492D8BBF1
Sequence
CCTAACAAATCTGTGAATGTTCCTTTTCAGAGCACAGGAGCAAGCTTTACAGACGCTTAAAATAGCACTTGTGGAATGGA
ATAATCCCAAAAGTCCCGATATGGAACGGAATCCTTTTTGGGTCTTATTTTTAAATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91228217..91228358 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039830 (Olig2) NM_016967 oligodendrocyte transcription factor 2 Gene [Source:MGI (curated);Acc:Olig2-001]


Sequence tag IST11492D8HMF1
Sequence
CCTAACAAATCTGTGAATGTTCCTTTTCAGAGCACAGGAGCAAGCTTTACAGACGCTTAAAATAGCACTTGTGGAATGGA
ATAATCCCAAAAGTCCCGATATGGAACGGAATCCTTTTTGGGTCTTATTTTTAAATAGATCTCCCCCCACACACACGCAC
ACACACACTCACGCAACACACATTCTAAGCACACATCAATTGGTTTCTTACCCNACTGGGGACNCTGTTTTTTGGTACCT
GGGGGCTTGACAAAAGAACAACATCNAAAAGTTGCTGTGAATATANTTNGAGCTTTTTGGGAGGGGGTATTCTGTTGGGT
TTTTAATAATTTCTTGTGTGTGTAAATATAATATCAACGAANTGCGCGATGCNAAGCTCTTTGTTCACGTGACTCCCCCC
TCCGTCTAAGCCCGNTGTTTTCTTTCTGTGTCGTTGCCCTCCCACACACACACNTTTTGCCANCGTNNACG
Sequence Type genomic DNA
Unitrap ID UNI31461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91228217..91228682 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039830 (Olig2) NM_016967 oligodendrocyte transcription factor 2 Gene [Source:MGI (curated);Acc:Olig2-001]

 
Come back to gene ENSMUSG00000039830


For any suggestions or comments, please send an email to unitrap@crg.es