Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10818B5
Clone ID IST10818B5
Vector VICTR76
Project tigm

Sequence tag IST10818B5HMR1
Sequence
CNTAACACAGCATTTAGGAGAGTGGTCCAGGCAGGACCCTCCTATTGTGCTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI20645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110002794..110002846 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]


Sequence tag IST10818B5HMF1
Sequence
GAATCATGTAAGAACCAAGTAGTTATAAACAGTTCCTAAGCAGACTCAAGGAGAGTTGAACCCATCTTGCAGCCCTATGC
TAAGTAGATATGCACAGACACCACACCCCCAGATCTTCAAGATGGGTAAAGAAAGGCCAGCGAGCTCACTCCACCTATCT
TAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110002848..110003013 166
NO GENE  


Sequence tag IST10818B5BBF1
Sequence
GAATCATGTAAGAACCAAGTAGTTATAAACAGTTCCTAAGCAGACTCAAGGAGAGTTGAACCCATCTTGCAGCCCTATGC
TAAGTAGATATGCACAGACACCACACCCCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110002848..110002963 116
NO GENE  

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es