Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10082C11
Clone ID IST10082C11
Vector VICTR75
Project tigm

Sequence tag IST10082C11BBF1
Sequence
TTCTAGGTTACAAAAACAAAACAAACCATCAACCCAGAGCTGTATTCATGACAGGCAAGCCCTCTGCCAGAGCTATAACT
CTGACCCTAGATATTTTAACTCTGGTGGAAACCTCCAGAATGCTCCTTAAATTAAAACAAAACAAAACAAAACAAAACAA
AAACTAAGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGCTCTTGGAAGGCAGAGGCAGGAGGATTTCTGAGTTCGAG
GCCAGCCTGGTCTACAAAGTGAGTTCCAGAACAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAAAACAAAAAAAAAA
AAAAAACCCCCCCCAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974145..109974487 331
NO GENE  


Sequence tag IST10082C11BBR1
Sequence
AGACTAGCTTTGAACTTGTCATCTCTGGAGTGCTGCTGGAATTACAGGTGTGTGCTACGACATGCAGCCCTTACAGTGTT
TTAGAGGCTGAGTCCTACTGTGTAGCCCATACTGAACTCAGTGTTCCTCCTGTCTTTCAAGCTCTGGGATTATATATACA
TACCACAGTGCTCAGCTGCGGCGTAATGCTTTAATGGCAGCAGTTTCACAGTTAGCAAAACCCACCTGTCACTCATGTCT
CACTGTGGTCACGCTTGCATTGAAGGTGCTGCAGCCAAGACACCATTGGTGCTGTGGCCACAAGGGCTGTTGTCTTCACG
TTCTTTGTCACACACAGTCTTGGGAGAACACTTCAGTTCACAATCCTTGAAGGAGCTGCCTGTGTGGTGCATAACTTGCT
CCCAGCACTCAGGAGGCTGAGACAGGAGGATCTCTGTGAGTAAGAGGCCAGCCTGGTCTACAAGAGCATGTCAGGAAAGC
CAGTGCTACATAGTGACACTGTGTCTCAGAAAACAAACAACACATGTGAGAACTTGTTGTATTTTTTATATTTTTAAAAG
TTTGCATTCATGTGTGTGTCTATG
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109974485..109975066 574
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es