Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0273
Clone ID GC0273
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0273
Sequence
AGTGCATGTCTCGTTCATGCTCATACTCGATGAAGGCATAACCACGGGGTCTCTTCCAGAGCGTTTACTGTATACCATGT
GGATTCTTTTGATGGGTCCATACACCTCAAACTCTCTCCGAAGCTTAGATTCTGTTGTGTCATAGTTCACTCTAGCCACG
AACAGAGTCTTGAAGGCATCGCCCTGAGCATTGGGATCATTGTGAGGGTCCCCTGTACAAGGAGAAGAAAATCTTTAAAG
TATGACAGTGCTCACAATTTTGGGTAGAAGAGTGATGGGAAGAGACTGAATACATGAAGATGGAACCTATTCT
Sequence Type mRNA
Unitrap ID UNI28

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52639174..52642919 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es